ID: 1069132644_1069132647

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1069132644 1069132647
Species Human (GRCh38) Human (GRCh38)
Location 10:64726266-64726288 10:64726318-64726340
Sequence CCACGTATGAGGAAAGTGCAACA CAGTTTTTGGATCTGTAGAATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 30, 3: 330, 4: 2456}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!