ID: 1069137389_1069137398

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1069137389 1069137398
Species Human (GRCh38) Human (GRCh38)
Location 10:64782702-64782724 10:64782741-64782763
Sequence CCTTCTGGGCAGGGGAGATTAGA TAGGAAGGGGAGCTATAGGGAGG
Strand - +
Off-target summary {0: 90, 1: 51, 2: 73, 3: 48, 4: 226} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!