ID: 1069322675_1069322677

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1069322675 1069322677
Species Human (GRCh38) Human (GRCh38)
Location 10:67192195-67192217 10:67192212-67192234
Sequence CCAAAAGCACATGCAACAAAAGC AAAAGCAAAAAGATTTAAGTGGG
Strand - +
Off-target summary {0: 6, 1: 365, 2: 3693, 3: 18301, 4: 12677} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!