ID: 1069359692_1069359695

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1069359692 1069359695
Species Human (GRCh38) Human (GRCh38)
Location 10:67627326-67627348 10:67627349-67627371
Sequence CCTGGGTGCCACATGGGTACTCA GAACCCAGGACAACTAGAGTAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 21, 4: 140} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!