ID: 1069384957_1069384962

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1069384957 1069384962
Species Human (GRCh38) Human (GRCh38)
Location 10:67875815-67875837 10:67875835-67875857
Sequence CCCAGTTGAGAACCACTGATCTA CTAGGTTTATATACTGCTGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 21, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!