ID: 1069469664_1069469676

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1069469664 1069469676
Species Human (GRCh38) Human (GRCh38)
Location 10:68676659-68676681 10:68676709-68676731
Sequence CCCTCCTCCGCCTCCCAAAGTGC CTGGCCCACATCAATTTTTGAGG
Strand - +
Off-target summary {0: 65, 1: 9168, 2: 231903, 3: 271683, 4: 180620} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!