ID: 1069486518_1069486524

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1069486518 1069486524
Species Human (GRCh38) Human (GRCh38)
Location 10:68827415-68827437 10:68827438-68827460
Sequence CCTCCAGAGCGCTCCGCCGGCCT AAGCACGGCCGCCCCACCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 99} {0: 1, 1: 0, 2: 0, 3: 24, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!