ID: 1069547807_1069547813

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1069547807 1069547813
Species Human (GRCh38) Human (GRCh38)
Location 10:69341268-69341290 10:69341283-69341305
Sequence CCTCCCGCCTCAGTCTCCCGAGT TCCCGAGTAGCTGGGACTACAGG
Strand - +
Off-target summary {0: 19, 1: 607, 2: 9095, 3: 46722, 4: 92879} {0: 54379, 1: 173656, 2: 264604, 3: 194654, 4: 115454}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!