ID: 1069550425_1069550436

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1069550425 1069550436
Species Human (GRCh38) Human (GRCh38)
Location 10:69360373-69360395 10:69360424-69360446
Sequence CCCAGTGCAGGTTTAGCAGAGCC CATTGGCCTCACCCACTTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 118} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!