ID: 1069554008_1069554014

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1069554008 1069554014
Species Human (GRCh38) Human (GRCh38)
Location 10:69384857-69384879 10:69384894-69384916
Sequence CCAGGATGCCTCTGGGCTTCACG CCAGCAGACGAGTCTGGACGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 189} {0: 1, 1: 0, 2: 0, 3: 10, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!