ID: 1069664480_1069664486

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1069664480 1069664486
Species Human (GRCh38) Human (GRCh38)
Location 10:70145626-70145648 10:70145656-70145678
Sequence CCAGGGCAGCGGTGCTGTGCGGC GAAGCGCGTCGCGGGCGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 213} {0: 1, 1: 1, 2: 0, 3: 12, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!