ID: 1069686578_1069686592

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1069686578 1069686592
Species Human (GRCh38) Human (GRCh38)
Location 10:70322847-70322869 10:70322899-70322921
Sequence CCTCCCACCCAGCCAGGGTCAGA GCACTCGCACCACAGGAGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 2, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!