ID: 1069689759_1069689765

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1069689759 1069689765
Species Human (GRCh38) Human (GRCh38)
Location 10:70342563-70342585 10:70342598-70342620
Sequence CCTCAGTTTCCTCATCCACAGAA CAGCTGCCTAGCAGAGCTGTTGG
Strand - +
Off-target summary {0: 2, 1: 26, 2: 297, 3: 1507, 4: 6106} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!