ID: 1069689762_1069689765

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1069689762 1069689765
Species Human (GRCh38) Human (GRCh38)
Location 10:70342578-70342600 10:70342598-70342620
Sequence CCACAGAATGAAGGTACCACCAG CAGCTGCCTAGCAGAGCTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 150} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!