ID: 1069698428_1069698448

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1069698428 1069698448
Species Human (GRCh38) Human (GRCh38)
Location 10:70404632-70404654 10:70404672-70404694
Sequence CCCCGCCCCCAGCTCCACCGAAG TTGGGCCCGCCCGAGCGTTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 283} {0: 1, 1: 0, 2: 0, 3: 1, 4: 23}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!