ID: 1069721420_1069721425

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1069721420 1069721425
Species Human (GRCh38) Human (GRCh38)
Location 10:70551951-70551973 10:70551991-70552013
Sequence CCCGTTTCCTTCTGGGCTTCGTG CTGGAAGCTGTGATTGTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 179} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!