ID: 1069722191_1069722202

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1069722191 1069722202
Species Human (GRCh38) Human (GRCh38)
Location 10:70556928-70556950 10:70556968-70556990
Sequence CCAGGACCCTGCCTGGCACAAGT CTTTCTAGTGAGTGGATGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!