ID: 1069735433_1069735440

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1069735433 1069735440
Species Human (GRCh38) Human (GRCh38)
Location 10:70650868-70650890 10:70650881-70650903
Sequence CCACCCATTACTACTGTTTGCTG CTGTTTGCTGGGTGGGTAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 142} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!