ID: 1069749310_1069749322

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1069749310 1069749322
Species Human (GRCh38) Human (GRCh38)
Location 10:70735409-70735431 10:70735458-70735480
Sequence CCTGGTGATGGGCCCACAGACAC GAGTGAACACCTGTGGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 181} {0: 1, 1: 0, 2: 0, 3: 19, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!