ID: 1069751933_1069751942

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1069751933 1069751942
Species Human (GRCh38) Human (GRCh38)
Location 10:70750416-70750438 10:70750446-70750468
Sequence CCTGACTGGGGCACATCTCTGCC CCCTTCCTAGAGCATGGGCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!