ID: 1069761169_1069761180

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1069761169 1069761180
Species Human (GRCh38) Human (GRCh38)
Location 10:70812604-70812626 10:70812657-70812679
Sequence CCCATGATAACTCGGTGACTTGC GGGGCATTTGGTCCCTGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 31} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!