ID: 1069761819_1069761834

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1069761819 1069761834
Species Human (GRCh38) Human (GRCh38)
Location 10:70816288-70816310 10:70816321-70816343
Sequence CCGCTGAGGTCCAAGCAAGTGGA GCGCGGGGCCGCGGTGGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 160} {0: 1, 1: 0, 2: 7, 3: 153, 4: 1011}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!