ID: 1069764289_1069764298

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1069764289 1069764298
Species Human (GRCh38) Human (GRCh38)
Location 10:70841626-70841648 10:70841660-70841682
Sequence CCCTCTTCCTCCTACCATCAGCT TTTCAACATATGAATTTTTGGGG
Strand - +
Off-target summary No data {0: 28, 1: 444, 2: 1606, 3: 3278, 4: 4796}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!