ID: 1069764289_1069764299

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1069764289 1069764299
Species Human (GRCh38) Human (GRCh38)
Location 10:70841626-70841648 10:70841661-70841683
Sequence CCCTCTTCCTCCTACCATCAGCT TTCAACATATGAATTTTTGGGGG
Strand - +
Off-target summary No data {0: 28, 1: 372, 2: 1349, 3: 2634, 4: 3546}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!