ID: 1069764290_1069764296

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1069764290 1069764296
Species Human (GRCh38) Human (GRCh38)
Location 10:70841627-70841649 10:70841658-70841680
Sequence CCTCTTCCTCCTACCATCAGCTT GATTTCAACATATGAATTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 100, 4: 852} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!