ID: 1069764396_1069764405

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1069764396 1069764405
Species Human (GRCh38) Human (GRCh38)
Location 10:70842875-70842897 10:70842913-70842935
Sequence CCCCTGTCCATGTTTGTATTCAG GGGCACTCTGCCACATGTTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 18, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!