ID: 1069769360_1069769376

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1069769360 1069769376
Species Human (GRCh38) Human (GRCh38)
Location 10:70887930-70887952 10:70887978-70888000
Sequence CCCCCGCCCCGGGGGTGGGTGGG CCAGCGCCACCAAGCCCCCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 383} {0: 1, 1: 0, 2: 1, 3: 10, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!