ID: 1069769485_1069769496

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1069769485 1069769496
Species Human (GRCh38) Human (GRCh38)
Location 10:70888364-70888386 10:70888399-70888421
Sequence CCTCCCCGCCGCCAGCGACAGAG ACCCCACTTTCGGACCCCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 160} {0: 1, 1: 0, 2: 0, 3: 4, 4: 46}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!