ID: 1069776608_1069776613

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1069776608 1069776613
Species Human (GRCh38) Human (GRCh38)
Location 10:70930958-70930980 10:70930977-70930999
Sequence CCAAAAAACAGTTCCCGGTCCTG CCTGCTTTTCCAGCCCCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 63} {0: 1, 1: 0, 2: 0, 3: 33, 4: 411}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!