ID: 1069783065_1069783070

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1069783065 1069783070
Species Human (GRCh38) Human (GRCh38)
Location 10:70969091-70969113 10:70969114-70969136
Sequence CCCACTACCCTCAGTCAGTGACA TTTTCTTTATTGATAGTGGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!