ID: 1069837584_1069837591

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1069837584 1069837591
Species Human (GRCh38) Human (GRCh38)
Location 10:71319124-71319146 10:71319163-71319185
Sequence CCAGAAGGGGGAGCCCCGGCGCG GAAAAAAGCGTGTTTGCAAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 94} {0: 1, 1: 0, 2: 1, 3: 41, 4: 346}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!