ID: 1069842402_1069842408

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1069842402 1069842408
Species Human (GRCh38) Human (GRCh38)
Location 10:71348008-71348030 10:71348039-71348061
Sequence CCGAGGCTGGCGGATGCTTCCAG CCTGCCATGCTGAGGCAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 261} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!