ID: 1069847074_1069847078

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1069847074 1069847078
Species Human (GRCh38) Human (GRCh38)
Location 10:71379818-71379840 10:71379837-71379859
Sequence CCGAGTGCACTTTGTGGACACTG ACTGCTGGCCTGAAATAGTGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!