ID: 1069861037_1069861046

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1069861037 1069861046
Species Human (GRCh38) Human (GRCh38)
Location 10:71471984-71472006 10:71472030-71472052
Sequence CCCCACATCTACAGGTGTGCCTG TGATAGGTGATTCAGTTTCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 16, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!