ID: 1069905595_1069905602

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1069905595 1069905602
Species Human (GRCh38) Human (GRCh38)
Location 10:71730449-71730471 10:71730465-71730487
Sequence CCCTGGCCCGGCTCCCACAGGTG ACAGGTGATTGTGTACGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 246} {0: 1, 1: 0, 2: 0, 3: 12, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!