ID: 1069942464_1069942483

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1069942464 1069942483
Species Human (GRCh38) Human (GRCh38)
Location 10:71964758-71964780 10:71964807-71964829
Sequence CCCCCGCCTTCCGCGTCCAGGCG GGGGCGAAGCGGACGGTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 621, 4: 11213} {0: 1, 1: 0, 2: 2, 3: 20, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!