ID: 1069959450_1069959459

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1069959450 1069959459
Species Human (GRCh38) Human (GRCh38)
Location 10:72071035-72071057 10:72071078-72071100
Sequence CCATGCCCCTGCAGCCTTCTAAG CTTCTATGATTCAGGAAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 62, 4: 379} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!