ID: 1069960066_1069960074

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1069960066 1069960074
Species Human (GRCh38) Human (GRCh38)
Location 10:72074216-72074238 10:72074249-72074271
Sequence CCAAGGCCTTCAGGCTTCTGAAG AAGCTGGCAAGCGTCAGAGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 6, 3: 54, 4: 393}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!