ID: 1069960067_1069960074

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1069960067 1069960074
Species Human (GRCh38) Human (GRCh38)
Location 10:72074222-72074244 10:72074249-72074271
Sequence CCTTCAGGCTTCTGAAGCCTCCC AAGCTGGCAAGCGTCAGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 101, 4: 1277} {0: 1, 1: 1, 2: 6, 3: 54, 4: 393}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!