ID: 1069960067_1069960079

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1069960067 1069960079
Species Human (GRCh38) Human (GRCh38)
Location 10:72074222-72074244 10:72074274-72074296
Sequence CCTTCAGGCTTCTGAAGCCTCCC GGGTGAGGCCTCCTGGACAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 101, 4: 1277} {0: 1, 1: 0, 2: 2, 3: 20, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!