ID: 1069988139_1069988154

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1069988139 1069988154
Species Human (GRCh38) Human (GRCh38)
Location 10:72297992-72298014 10:72298030-72298052
Sequence CCCAGCGAGCGTGACCCCGACCC CCCGTAGGATCGCGGGCGCGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 2, 4: 39}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!