ID: 1070063586_1070063591

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1070063586 1070063591
Species Human (GRCh38) Human (GRCh38)
Location 10:73010753-73010775 10:73010800-73010822
Sequence CCACTATTTGGGAGGCTGAGGCT GTGAGCCATGTTTATACTGCTGG
Strand - +
Off-target summary {0: 1, 1: 32, 2: 584, 3: 1967, 4: 3934} {0: 1, 1: 0, 2: 1, 3: 16, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!