ID: 1070106488_1070106490

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1070106488 1070106490
Species Human (GRCh38) Human (GRCh38)
Location 10:73437074-73437096 10:73437095-73437117
Sequence CCATTTAGTTTAACCAAGCAGTT TTCAGTAACTATCAAAAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 145} {0: 1, 1: 0, 2: 3, 3: 37, 4: 416}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!