ID: 1070127158_1070127167

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1070127158 1070127167
Species Human (GRCh38) Human (GRCh38)
Location 10:73631811-73631833 10:73631832-73631854
Sequence CCTTTTTCCCTCCATTCCCATAA AAGGATACTGGATTAACAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 543} {0: 1, 1: 0, 2: 1, 3: 12, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!