ID: 1070127585_1070127587

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1070127585 1070127587
Species Human (GRCh38) Human (GRCh38)
Location 10:73634579-73634601 10:73634593-73634615
Sequence CCCAGATGGTGCTGCTGATCAGA CTGATCAGAGCCATACTGTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 308} {0: 1, 1: 0, 2: 0, 3: 6, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!