ID: 1070127585_1070127590

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1070127585 1070127590
Species Human (GRCh38) Human (GRCh38)
Location 10:73634579-73634601 10:73634616-73634638
Sequence CCCAGATGGTGCTGCTGATCAGA CAGAGCCACTGCCCCCTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 308} {0: 1, 1: 1, 2: 9, 3: 222, 4: 3189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!