ID: 1070162556_1070162585

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1070162556 1070162585
Species Human (GRCh38) Human (GRCh38)
Location 10:73874666-73874688 10:73874717-73874739
Sequence CCGGCCCCCGGCCCGCCCCCGGG CGCCCCGGAGCCGCCCTCGCTGG
Strand - +
Off-target summary {0: 2, 1: 7, 2: 38, 3: 290, 4: 1993} {0: 1, 1: 0, 2: 3, 3: 19, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!