ID: 1070162561_1070162585

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1070162561 1070162585
Species Human (GRCh38) Human (GRCh38)
Location 10:73874671-73874693 10:73874717-73874739
Sequence CCCCGGCCCGCCCCCGGGGAGGG CGCCCCGGAGCCGCCCTCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 52, 4: 420} {0: 1, 1: 0, 2: 3, 3: 19, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!