ID: 1070255917_1070255927

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1070255917 1070255927
Species Human (GRCh38) Human (GRCh38)
Location 10:74813289-74813311 10:74813316-74813338
Sequence CCCTGGAGACCCAAGTCCAGGGG GGGTGCACTCAGATGGAGAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 27, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!