ID: 1070277862_1070277866

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1070277862 1070277866
Species Human (GRCh38) Human (GRCh38)
Location 10:75024961-75024983 10:75024977-75024999
Sequence CCTTTTGTACTAAAGAAGAAAAG AGAAAAGGGGTCGTAAACGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 73, 4: 971} {0: 1, 1: 0, 2: 0, 3: 3, 4: 53}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!